top of page

The LaBella Lab

Our Work

yeast_colonies_edited.jpg

Our Research

What do you see when you look at a DNA sequence like ATAGCAGCCGACCGACGACGGCA? Do you see four letters repeated at random? Encoded in these four letters are the genes that create the proteins used to build our entire bodies. But genes aren’t the only information hidden in these four letters. Using new computational methods, we can analyze genomic sequences to learn about the evolutionary past, the phenotypic present, and even about future potential. In the LaBella Lab we study the patterns encoded in DNA focusing on the following major questions
​

  1. What information is encoded in “silent” synonymous genomic variation?

  2. What role does “silent” synonymous genomic variation play in evolution?

  3. How can genomics inform complex trait evolution?

cell.png

Budding Yeast

tree.png

Evolution of Complex Traits

codon_table.png

Codon Usage Bias

Pink Oyster Mushrooms

Our Team

Meet the incredible scientists who make our work possible

Close-Up of Coral Texture

Lab News

Check out the latest news from the LaBella Lab

Mogana Das Murtey and Patchamuthu Ramasamy - https://www.intechopen.com/chapters/49652

Publications

The full bibliography of the LaBella lab

jkaf184.jpg
Opulente_LaBella_2024_science.adj4503_Page_01.jpg

Wild Yeast

What yeast are living amongst us in North Carolina? The LaBella lab is sequencing the genomes of wild yeast isolates to learn more about the microbes around us

20250528_091213.jpg
20250602_110110.jpg
bottom of page